galectin 9 ligand (Galectin Therapeutics)
86
Structured Review
Galectin Therapeutics
galectin 9 ligand
Galectin 9 Ligand, supplied by Galectin Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/galectin-9/lgals3/pm42274584-45-25-25
Average 86 stars, based on 1 article reviews
Galectin 9 Ligand, supplied by Galectin Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/galectin-9/lgals3/pm42274584-45-25-25
Average 86 stars, based on 1 article reviews
galectin 9 ligand - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Clinical Proteomics:Article Title: Article Snippet: Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Following AHSCT, biomarker concentrations decreased from baseline to the 1-year follow-up, with a Article Title: Article Snippet: Primer sequences Gene name Forward primer Reverse primer hIL12A CACAAAAGATAAAACCAGCA CTCTCTGGAATTTAGGCAAC hIL6 GACAGCCACTCACCTCTTCAGAACG ATCCATCTTTTTCAGCCATCTTTGG hIL10 TCAAGGCGCATGTGAACTCC GATGTCAAACTCACTCATGGCT hTNFα ATGAGCACTGAAAGCATGATCC GAGGGCTGATTAGAGAGAGGTC ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAACGCA Supplementary Figure 1 % Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Following AHSCT, the CSF concentrations of Gal-9 and YKL-40 decreased from baseline to the 1-year follow-up, with a Article Title: Impact of endocrine disrupting chemicals on macrophages at the maternal-fetal interface. Article Snippet: and phagocytosis of apoptotic cells [6–9].. In early pregnancy 30–40% of decidual cells are leukocytes, with macrophages accounting for 20–30% of them, ranking as the second most abundant population after uNK cells (60–70%) [10, 11].. However, a recent study analyzed the number of immune cells in decidua of the early pregnancy by imaging mass cytometry (IMC) and showed that the number of macrophages was higher than uNK cells in all three trimesters of pregnancy [12]. Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Galectin-9 and YKL-40 concentrations decreased further and were even lower at the 2-year follow-up; Article Title: Effect of the TIM-3/Gal-9 signaling pathway on macrophage polarization in peri-implantitis Article Snippet: Its Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: This study aimed to investigate whether three cerebrospinal fluid biomarkers of Biomarker Discovery:Article Title: Article Snippet: Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Following AHSCT, biomarker concentrations decreased from baseline to the 1-year follow-up, with a Article Title: Article Snippet: Primer sequences Gene name Forward primer Reverse primer hIL12A CACAAAAGATAAAACCAGCA CTCTCTGGAATTTAGGCAAC hIL6 GACAGCCACTCACCTCTTCAGAACG ATCCATCTTTTTCAGCCATCTTTGG hIL10 TCAAGGCGCATGTGAACTCC GATGTCAAACTCACTCATGGCT hTNFα ATGAGCACTGAAAGCATGATCC GAGGGCTGATTAGAGAGAGGTC ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAACGCA Supplementary Figure 1 % Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Following AHSCT, the CSF concentrations of Gal-9 and YKL-40 decreased from baseline to the 1-year follow-up, with a Article Title: Impact of endocrine disrupting chemicals on macrophages at the maternal-fetal interface. Article Snippet: and phagocytosis of apoptotic cells [6–9].. In early pregnancy 30–40% of decidual cells are leukocytes, with macrophages accounting for 20–30% of them, ranking as the second most abundant population after uNK cells (60–70%) [10, 11].. However, a recent study analyzed the number of immune cells in decidua of the early pregnancy by imaging mass cytometry (IMC) and showed that the number of macrophages was higher than uNK cells in all three trimesters of pregnancy [12]. Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Galectin-9 and YKL-40 concentrations decreased further and were even lower at the 2-year follow-up; Article Title: Effect of the TIM-3/Gal-9 signaling pathway on macrophage polarization in peri-implantitis Article Snippet: Its Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: This study aimed to investigate whether three cerebrospinal fluid biomarkers of Electrochemiluminescence:Article Title: Article Snippet: Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Following AHSCT, biomarker concentrations decreased from baseline to the 1-year follow-up, with a Article Title: Article Snippet: Primer sequences Gene name Forward primer Reverse primer hIL12A CACAAAAGATAAAACCAGCA CTCTCTGGAATTTAGGCAAC hIL6 GACAGCCACTCACCTCTTCAGAACG ATCCATCTTTTTCAGCCATCTTTGG hIL10 TCAAGGCGCATGTGAACTCC GATGTCAAACTCACTCATGGCT hTNFα ATGAGCACTGAAAGCATGATCC GAGGGCTGATTAGAGAGAGGTC ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAACGCA Supplementary Figure 1 % Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Following AHSCT, the CSF concentrations of Gal-9 and YKL-40 decreased from baseline to the 1-year follow-up, with a Article Title: Impact of endocrine disrupting chemicals on macrophages at the maternal-fetal interface. Article Snippet: and phagocytosis of apoptotic cells [6–9].. In early pregnancy 30–40% of decidual cells are leukocytes, with macrophages accounting for 20–30% of them, ranking as the second most abundant population after uNK cells (60–70%) [10, 11].. However, a recent study analyzed the number of immune cells in decidua of the early pregnancy by imaging mass cytometry (IMC) and showed that the number of macrophages was higher than uNK cells in all three trimesters of pregnancy [12]. Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Galectin-9 and YKL-40 concentrations decreased further and were even lower at the 2-year follow-up; Article Title: Effect of the TIM-3/Gal-9 signaling pathway on macrophage polarization in peri-implantitis Article Snippet: Its Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: This study aimed to investigate whether three cerebrospinal fluid biomarkers of Multiplex Assay:Article Title: Article Snippet: Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Following AHSCT, biomarker concentrations decreased from baseline to the 1-year follow-up, with a Article Title: Article Snippet: Primer sequences Gene name Forward primer Reverse primer hIL12A CACAAAAGATAAAACCAGCA CTCTCTGGAATTTAGGCAAC hIL6 GACAGCCACTCACCTCTTCAGAACG ATCCATCTTTTTCAGCCATCTTTGG hIL10 TCAAGGCGCATGTGAACTCC GATGTCAAACTCACTCATGGCT hTNFα ATGAGCACTGAAAGCATGATCC GAGGGCTGATTAGAGAGAGGTC ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAACGCA Supplementary Figure 1 % Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Following AHSCT, the CSF concentrations of Gal-9 and YKL-40 decreased from baseline to the 1-year follow-up, with a Article Title: Impact of endocrine disrupting chemicals on macrophages at the maternal-fetal interface. Article Snippet: and phagocytosis of apoptotic cells [6–9].. In early pregnancy 30–40% of decidual cells are leukocytes, with macrophages accounting for 20–30% of them, ranking as the second most abundant population after uNK cells (60–70%) [10, 11].. However, a recent study analyzed the number of immune cells in decidua of the early pregnancy by imaging mass cytometry (IMC) and showed that the number of macrophages was higher than uNK cells in all three trimesters of pregnancy [12]. Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: Galectin-9 and YKL-40 concentrations decreased further and were even lower at the 2-year follow-up; Article Title: Effect of the TIM-3/Gal-9 signaling pathway on macrophage polarization in peri-implantitis Article Snippet: Its Article Title: Biomarkers of progressive multiple sclerosis decrease following autologous hematopoietic stem cell transplantation Article Snippet: This study aimed to investigate whether three cerebrospinal fluid biomarkers of |